DeNunCianDo  
Denunciando   Urbantuning   Futbol Es Pasion   Video Porno luly bossa Completo   Video Porno Sandra Muños Completo   Alejandra Omaña Primer video porno   Lina Arroyave, DESNUDA, la mama del hijo de Kevin Roldan   

Retroceder   DeNunCianDo » ..:::: CoMuNiDaD DeNunCianDo.CoM ::::.. » Discusiones Generales » Hablar Mierdita

Hablar Mierdita ¿Sin nada para hacer? ¿Con ganas de dejar fluir todo tu autismo? Pues encontraste el lugar indicado. Entra acá, habla de lo que quieras, sin temor a que te rechacen por sólo hablar mierdita Los mensajes en esta Zona No cuentan

Hola Invitado!
Tómate un minuto para registrarte, es 100% GRATIS y no verás ninguna publicidad! ¿Qué estás esperando?
tapatalk Para Ingresa a Denunciando.com por medio de TapaTalk Clic ACA
Registrarse Ahora
Hablar Mierdita »

..:: Karaoke De Batalla ::..

Participa en el tema ..:: Karaoke De Batalla ::.. en el foro Hablar Mierdita.
tururururururururru splassssssshhhhhh purrucutuuu los cantores de chipucooooooo djdjdjdj otavio djdjdjdj otavio djdjdjdj otavio omee....



Temas Similares
Tema Autor Foro Respuestas Último mensaje
Karaoke CD G Creator Pro v2.19, Creat tus Propios CDs de Karaoke ABE28 Software - Programas 4 11-12-2009 12:05:44
Dart Karaoke Studio - Crear tu propia música para Karaoke Usando tus Audio WeBMaSTeR_ShEvI Software - Programas 5 20-10-2009 16:55:32
KARAOKE jajajaja kristian Chistes / Cosas Charras 6 02-03-2009 10:53:11
Karaoke Seth Software - Programas 1 22-11-2008 22:15:57
Karaoke Rock !!! OoOops !!! Rock 4 17-11-2008 15:11:49

Like Tree1Me Gusta

Respuesta
Antiguo 09-06-2006 , 17:36:10   #461
Denunciante Importante
No Tiene Avatar Configurado
Me Gusta
Estadisticas
Mensajes: 6.990
Me Gusta Recibidos: 10
Me Gustas Dados: 9
Ingreso: 21 nov 2005

Temas Nominados a TDM
Temas Nominados Temas Nominados 0
Nominated Temas Ganadores: 0
Reputacion
Puntos: 38496
Wisiи∂*(( Es un dios del foroWisiи∂*(( Es un dios del foroWisiи∂*(( Es un dios del foroWisiи∂*(( Es un dios del foroWisiи∂*(( Es un dios del foroWisiи∂*(( Es un dios del foroWisiи∂*(( Es un dios del foroWisiи∂*(( Es un dios del foroWisiи∂*(( Es un dios del foroWisiи∂*(( Es un dios del foroWisiи∂*(( Es un dios del foro
  
Predeterminado

tururururururururru splassssssshhhhhh purrucutuuu

los cantores de chipucooooooo djdjdjdj otavio
djdjdjdj otavio
djdjdjdj otavio omee

Comentarios Facebook

__________________




Última edición por Wisiи∂*((; 09-06-2006 a las 18:00:02
Wisiи∂*(( no está en línea   Responder Citando

compartir
                 
remocion sep Gold sep Silver sep Donar

marcaNo Calculado   #1.5
SponSor

avatar
 
Me Gusta denunciando
Estadisticas
Mensajes: 898.814
Me Gusta Recibidos: 75415
Me Gustado Dados: 62988
Fecha de Ingreso: 02 jun 2006
Reputacion
Puntos: 1574370
Ayudante de Santa está en el buen caminoAyudante de Santa está en el buen caminoAyudante de Santa está en el buen caminoAyudante de Santa está en el buen caminoAyudante de Santa está en el buen caminoAyudante de Santa está en el buen caminoAyudante de Santa está en el buen caminoAyudante de Santa está en el buen caminoAyudante de Santa está en el buen caminoAyudante de Santa está en el buen caminoAyudante de Santa está en el buen caminoAyudante de Santa está en el buen caminoAyudante de Santa está en el buen caminoAyudante de Santa está en el buen camino
emoticon Re:

 
 
   
   
_______________________________________________
Publicidad :)
conectado
Antiguo 09-06-2006 , 17:55:56   #462
Denunciante Constante
 
Avatar de renewfenix
Me Gusta
Estadisticas
Mensajes: 910
Me Gusta Recibidos: 3
Me Gustas Dados: 0
Ingreso: 01 dic 2005

Temas Nominados a TDM
Temas Nominados Temas Nominados 0
Nominated Temas Ganadores: 0
Reputacion
Puntos: 524
renewfenix el Usuariox tiene un aura espectacularrenewfenix el Usuariox tiene un aura espectacularrenewfenix el Usuariox tiene un aura espectacularrenewfenix el Usuariox tiene un aura espectacularrenewfenix el Usuariox tiene un aura espectacularrenewfenix el Usuariox tiene un aura espectacular
  
Predeterminado

pan pan pan pan pan .......aqui se canta el jororpo aqui se canta el joropo
jajaja no se se mas sino que eso

__________________

LAS VENTAJAS DE LAS CENIZAS ES QUE PUEDES RENACER..............


FIREFOX LO MEJOR EN NAVEGADORES WEB, INTERNET EXPLORER TE QUEDASTE EN LA OLLA

renewfenix no está en línea   Responder Citando
Antiguo 09-06-2006 , 17:59:44   #463
Denunciante Aventajado
 
Avatar de **AnaC**
Me Gusta
Estadisticas
Mensajes: 3.207
Me Gusta Recibidos: 10
Me Gustas Dados: 5
Ingreso: 26 abr 2006

Temas Nominados a TDM
Temas Nominados Temas Nominados 0
Nominated Temas Ganadores: 0
Reputacion
Puntos: 20898
**AnaC** Es un explendido maestro**AnaC** Es un explendido maestro**AnaC** Es un explendido maestro**AnaC** Es un explendido maestro**AnaC** Es un explendido maestro**AnaC** Es un explendido maestro**AnaC** Es un explendido maestro**AnaC** Es un explendido maestro**AnaC** Es un explendido maestro**AnaC** Es un explendido maestro**AnaC** Es un explendido maestro
  
Predeterminado

Late at night I close my eyes
And think how things coulda been
And when I look back
I remember some words you had said to me
It's better to have lost at love
Then never to have loved at all

*I won't forget you baby, (I won't forget you)
Even though I could
I won't forget you baby, (I won't forget you)
Even though I should, yeah

Sometimes, in my head
I can still see pictures of you
And I laugh to myself
When I think of all those crazy things that we used to do
All the miles come between us
Just between you and me


__________________
A mi me gustó!
................................................
Te adoro como nunca


**AnaC** no está en línea   Responder Citando
Antiguo 09-06-2006 , 18:25:09   #464
Denunciante Encarretado
 
Avatar de astronomo
Me Gusta
Estadisticas
Mensajes: 739
Me Gusta Recibidos: 10
Me Gustas Dados: 20
Ingreso: 20 may 2006

Temas Nominados a TDM
Temas Nominados Temas Nominados 1
Nominated Temas Ganadores: 0
Reputacion
Puntos: 1265
astronomo el Usuariox ya es un nombre que todos conocenastronomo el Usuariox ya es un nombre que todos conocenastronomo el Usuariox ya es un nombre que todos conocenastronomo el Usuariox ya es un nombre que todos conocenastronomo el Usuariox ya es un nombre que todos conocenastronomo el Usuariox ya es un nombre que todos conocenastronomo el Usuariox ya es un nombre que todos conocenastronomo el Usuariox ya es un nombre que todos conocenastronomo el Usuariox ya es un nombre que todos conocen
  
Predeterminado

25, ya es navidad. todos juntos vamos a brindar
Por ruanda, etiopía, en venezuela o en la india
Hoy mueren niños, ¡feliz navidad!

Navidades de hambre y dolor, ha nacido el hijo de dios
El mesías que nos guía, ofrece su filosofía
Nadie entiende al hijo de dios

Mi familia comienza a cantar, en el ambiente hay felicidad
En compañía vamos a olvidar la agonía de los pueblos
Donde no hay navidad

Cantemos, hermanos, todos juntos hacia el vaticano
Suelta prenda, ¡coño!, que mueren niños de inanición
Un negocio millonario con la fé de los cristianos
Que utilizan a jesús como el perpetuo salvador

Jesucristo era un tío normal, pacifista, intelectual
Siempre al lado de los pobres defendiendo sus valores
Siempre en contra del capital

Crucificado como un animal, defendiendo un ideal
El abuso de riqueza se convierte en la miseria más injusta
De la humanidad

Mi familia comienza a cantar, en el ambiente hay felicidad
En compañía vamos a olvidar la agonía de los pueblos
Donde no hay navidad

Cantemos, hermanos, todos juntos hacia el vaticano
Suelta prenda, ¡coño!, que mueren niños de inanición
Un negocio millonario con la fe de los cristianos
Que utilizan a jesús como el perpetuo salvador

Fue la iglesia la que se lo montó
Y de su muerte un negocio creo
El vaticano es un imperio que devora con ingenio
Predicando por la caridad

25, ya es navidad, todos juntos vamos a brindar
Por un revolucionario que intentó cambiar el mundo
El primer hippie de la humanidad

Mi familia comienza a cantar, en el ambiente hay felicidad
En compañía vamos a olvidar la agonía de los pueblos
Donde no hay navidad

Cantemos, hermanos, todos juntos hacia el vaticano
Suelta prenda, ¡coño!, que mueren niños de inanición
Un negocio millonario conla fé de los cristianos
Que utilizan a jesús como el perpetuo salvador

Cantemos, hermanos, todos juntos hacia el vaticano
Suelta prenda, ¡coño!, que mueren niños de inanición
Un negocio millonario conla fé de los cristianos
Que utilizan a jesús como el perpetuo salvador

La navidad, la navidad, es la sociedad de consumo
Mentira, mentira, la navidad es mentira...
Mentira, mentira, la navidad es mentira...
Mentira, mentira, la navidad es mentira...

Mentira, mentira, la navidad es mentira...
Mentira, mentira, la navidad es mentira...
Mentira, mentira, la navidad es mentira...
Mentira, mentira, mentira...

astronomo no está en línea   Responder Citando
Antiguo 09-06-2006 , 18:46:08   #465
Denunciante Activo
 
Avatar de ((( eLi VaNeGaS )))
Me Gusta
Estadisticas
Mensajes: 1.873
Me Gusta Recibidos: 12
Me Gustas Dados: 41
Ingreso: 26 jun 2005

Temas Nominados a TDM
Temas Nominados Temas Nominados 0
Nominated Temas Ganadores: 0
Reputacion
Puntos: 534
((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular
  
Predeterminado

Dicen por ahí que el vicio de amarte es maloPero a mi me hace falta besar tus lindos labiosDicen que tu amor es un veneno muy maloPero a mi no me importa aunque tu maldad me haga dañoQue digan lo que diganSe han ido enamorando de tiPues tu me gustas mucho mujerTu amor tu me has robadoQue importa que yo mueraPor culpa de tu bocaPorque te llevo dentro de miMi alma me destrozaQuiero perderme contigoEn el vicio de tus labiosPégame tu vicio jooel vicio de tus labiospégame tu vicio mamiel vicio de tus labioswwwoooo jowwwoooo jowwwoooo jowwwoooo jo(dame mas mi amor)(pégame tu vicio)tatatatatatatatatatatacomo las mujeres dicentatatatatatatatatataque lo sepan en Paris que te amono me importa si eres una perdidasi bebes y fumas esa es tu vidapégame tu vicio mami el vicio de tus labiosPégame tu vicio jooel vicio de tus labioswwwoooo jowwwoooo jowwwoooo jowwwoooo jodame dame dameahí pégame el vicioa ver a ver una vez mas con la sonrisatatatatatatatatatatadímelo martíntatatattatatatatatacuídalos muchoque ricopégame tu vicio mami pégame tu viciopégame tu vicio mami pégame tu viciopégame tu vicio mami pégame tu viciopégame tu vicio mami pégame tu vicioyo yo pégame tu vicio pégame pégamepégame tu vicio venahí no me importa el vicio de tus labiospégamePégame tu vicio jooel vicio de tus labiosven pégame tu vicio mamiel vicio de tus labioswwwoooo jowwwoooo jowwwoooo jowwwoooo jodame mas dame masy sigo en el áreano me importa si eres una perdidasi bebes y fumas esa es tu vidano me importa si eres una perdidapero ven pégame tu viciono me importa si eres una perdidaahí no me importa si fumas esa es tu vidano me importa si eres una perdidasi bebes, si fumas, si bebes, si fumas espégame tu vicio mamipégame tu viciopégame tu vicio mamipégame tu viciopégame tu vicio mamipégame tu viciopégame tu vicio

__________________
- º§º»"*εїз eLÏ vªnÊgª§ εїз*"«º§º×-•´¯`•¤×º°.


http://img513.imageshack.us/img513/3476/eli4xq.jpg
http://img108.imageshack.us/img108/4...ily30wd4hj.gif
((( eLi VaNeGaS ))) no está en línea   Responder Citando
Antiguo 09-06-2006 , 18:48:30   #466
Denunciante Notable
 
Avatar de AnDrIu
Me Gusta
Estadisticas
Mensajes: 7.394
Me Gusta Recibidos: 9
Me Gustas Dados: 15
Ingreso: 07 jul 2005

Temas Nominados a TDM
Temas Nominados Temas Nominados 0
Nominated Temas Ganadores: 0
Reputacion
Puntos: 22543
AnDrIu Es un explendido maestroAnDrIu Es un explendido maestroAnDrIu Es un explendido maestroAnDrIu Es un explendido maestroAnDrIu Es un explendido maestroAnDrIu Es un explendido maestroAnDrIu Es un explendido maestroAnDrIu Es un explendido maestroAnDrIu Es un explendido maestroAnDrIu Es un explendido maestroAnDrIu Es un explendido maestro
  
Predeterminado

Faltan 5 Para Las 12 El AÑo Va A Terminar Me Voy Corriendo Ami Casa Abrazar A Mi MamÁ

__________________
MELI ESPOSA FORAL TE AMO

El OrGuLlO EsTa En La HiNcHaDa.
AnDrIu no está en línea   Responder Citando
Antiguo 09-06-2006 , 18:52:16   #467
Denunciante Activo
 
Avatar de ((( eLi VaNeGaS )))
Me Gusta
Estadisticas
Mensajes: 1.873
Me Gusta Recibidos: 12
Me Gustas Dados: 41
Ingreso: 26 jun 2005

Temas Nominados a TDM
Temas Nominados Temas Nominados 0
Nominated Temas Ganadores: 0
Reputacion
Puntos: 534
((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular
  
Predeterminado

Esta va para .....

Còmo quieres ser mi amiga
si por ti darìa la vida,
si confundo tu sonrisa
por camelo si me miras.
razòn y piel, difìcil mezcla,
agua y sed, serio problema.
Còmo quieres ser mi amiga
si por ti me perderia,
si confundo tus caricias
por camelo si me mimas.




__________________
- º§º»"*εїз eLÏ vªnÊgª§ εїз*"«º§º×-•´¯`•¤×º°.


http://img513.imageshack.us/img513/3476/eli4xq.jpg
http://img108.imageshack.us/img108/4...ily30wd4hj.gif
((( eLi VaNeGaS ))) no está en línea   Responder Citando
Antiguo 09-06-2006 , 18:53:38   #468
Denunciante Activo
 
Avatar de ((( eLi VaNeGaS )))
Me Gusta
Estadisticas
Mensajes: 1.873
Me Gusta Recibidos: 12
Me Gustas Dados: 41
Ingreso: 26 jun 2005

Temas Nominados a TDM
Temas Nominados Temas Nominados 0
Nominated Temas Ganadores: 0
Reputacion
Puntos: 534
((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular
  
Predeterminado

hola que tal soy el chico de las poesias
tu fiel admirador y aunque no me conocias
hoy es noche de sexo, voy a deborarte nena linda
hoy es noche de sexo y voy a cumplir tus fantasias
hoy es de noche de sexo, ayyy voy a deborarte nena linda
hoy es noche de sexo,
re lol

__________________
- º§º»"*εїз eLÏ vªnÊgª§ εїз*"«º§º×-•´¯`•¤×º°.


http://img513.imageshack.us/img513/3476/eli4xq.jpg
http://img108.imageshack.us/img108/4...ily30wd4hj.gif
((( eLi VaNeGaS ))) no está en línea   Responder Citando
Antiguo 09-06-2006 , 19:14:39   #469
Denunciante Enviciado
 
Avatar de *-Danyela 666-*
Me Gusta
Estadisticas
Mensajes: 2.633
Me Gusta Recibidos: 13
Me Gustas Dados: 12
Ingreso: 31 may 2005

Temas Nominados a TDM
Temas Nominados Temas Nominados 0
Nominated Temas Ganadores: 0
Reputacion
Puntos: 7092
*-Danyela 666-* es un pozo de sabiduria*-Danyela 666-* es un pozo de sabiduria*-Danyela 666-* es un pozo de sabiduria*-Danyela 666-* es un pozo de sabiduria*-Danyela 666-* es un pozo de sabiduria*-Danyela 666-* es un pozo de sabiduria*-Danyela 666-* es un pozo de sabiduria*-Danyela 666-* es un pozo de sabiduria*-Danyela 666-* es un pozo de sabiduria*-Danyela 666-* es un pozo de sabiduria*-Danyela 666-* es un pozo de sabiduria
  
Predeterminado

EL MAR ESCUPIA UN LAMENTO
TAN TENUE KE NADIE LO OLLÓ
UN DOLOR DE TAN ADENTRO
KE TODA UNA COSTA MURIO



__________________

^^DaNyElA **-666-**^^


●●AQUÍ APRENDEMOS A REIR DE LLANTO Y A LLORAR CON CARCAJADAS●●●
*-Danyela 666-* no está en línea   Responder Citando
Antiguo 09-06-2006 , 19:15:48   #470
Denunciante Activo
 
Avatar de ((( eLi VaNeGaS )))
Me Gusta
Estadisticas
Mensajes: 1.873
Me Gusta Recibidos: 12
Me Gustas Dados: 41
Ingreso: 26 jun 2005

Temas Nominados a TDM
Temas Nominados Temas Nominados 0
Nominated Temas Ganadores: 0
Reputacion
Puntos: 534
((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular((( eLi VaNeGaS ))) el Usuariox tiene un aura espectacular
  
Predeterminado

Cómo podré encontrarte
Para sentir tu piel
Cómo será tu cuerpo
que me voy a enloquecer
sueño con besarte
me llenas de ilusión
sólo con palabras me robaste el corazón



__________________
- º§º»"*εїз eLÏ vªnÊgª§ εїз*"«º§º×-•´¯`•¤×º°.


http://img513.imageshack.us/img513/3476/eli4xq.jpg
http://img108.imageshack.us/img108/4...ily30wd4hj.gif
((( eLi VaNeGaS ))) no está en línea   Responder Citando
Respuesta

Herramientas



La franja horaria es GMT -5. Ahora son las 05:28:45.
Desarrollado por: vBulletin® Versión 3.8.9
Derechos de Autor ©2000 - 2017, Jelsoft Enterprises Ltd.
DeNunCianDo.CoM ©
DeNunCianDo


Page generated in 0,15680 seconds with 23 queries

SEO by vBSEO